AmF C bisa.. kuputarkan kembali seperti dulu.. G Am ku bahagia tapi semuanya hilang, tanpa sebab F C G kau hentikan semuanya.. ho oooo.. F terluka dan menangis tapi kuterima Am semua keputusan yang telah kau buat F satu yang harus kau tahu Dm G ku menanti kau tuk kembali.. Reff : C G/B jujur ku tak ingin engkau pergi..
Kutak bisa jauh jauh darimu Int: C C Em Lalu mau apa lagi F C G Kalau kita sudah gak saling mengerti C Em Sampai kapan bertahan seperti ini F C Dua hati bercampur emosi G Dm F C G Tapi ku tak bisa jauh jauh darimu Dm F C G Ku tak bisa jauh jauh darimu Am Em Am Em Bb Gm Em Am Am Em Sabar sabar aku coba sadar Am Em Sadar sadar seharusnya kita sadar
A C#m D E Bm B F# G Em F#m Dm] Chords for Ku Tak Bisa Karaoke with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin.
ChordKunci Ukulele (Kentrung) Ku Tak Bisa - Adista, Kau Tak Pernah Berfikir Betapa Besar Cinta Ini • Chord Kunci Ukulele (Kentrung) Tak Ikhlasno - Happy Asmara, Ra Sepirone Loro Ati Iki • Chord Kunci Ukulele (Kentrung) Gede Roso - Abah Lala, Gede Roso Tresno Iki Tulus Kanggo Sliramu • Chord Kunci
ChordTablature, lyric, sheet, guitar, ukulele song: Tak Bisa Lagi Menyayangimu - ADA Band - ( [Am]Lantunan kidung cinta [Em]mengalun sedih Terlin[Dm]ta) Chords Songs 2 years ago 498 Heaven of Love (2004) ADA Band
TakBisa Memiliki CHORDS by Via Vallen for GUITAR, UKULELE, and PIANO !! CHORDS USED (Am, F, G, Dm, Em, C, E, A) ~ Released 2017 Intro Am F G Dm Am Em F Am F G Am Verse 1 Am F ku hanya bisa memandangmu G Am tanpa bisa memiliki Am F karena dirimu kekasih temanku G Am dan tak sendiri lagi Dm C mengapa kau masih jatuh G Em cinta padaku Dm C pasti Tak Bisa Memiliki CHORDS by Via Vallen
j1OW. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose EEFmEAEEEEEEEEEEEEEEEEEEEEEFmEAEEEEEFmEAEEEFmEEEFmEEEFmEEEBEEEAEEECmEBEAEEEBEEEAEEECmEBEAEEEBEEEEEEEEEEEEEFmEAEEEEEFmEAEEEFmEEEFmEEEFmEEEBEEEAEEECmEBEAEEEBEEEAEEECmEBEAEEEBEEEEEEEEEEEEEEEEEEEEEEECmEBEAEEEBCDEmAEEECmEBEAEEEEBEEAEEECmEBEAEEEEBEEAEEECmEBEAEEEBEEEAEEECmEBEAEEEEBEEEEFmEAEEEEEEEEEEEEEEEEEEEEEN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi 338 clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
11 Chords used in the song C, Em, F, G, Dm, Am, Bb, Gm, Bdim, Fm, Bm ← View these chords for the BaritoneTranspose chords Chord diagrams Pin chords to top while scrolling Tablature / Chords Full SongFont size A- A A+ No comment yet Need help, a tip to share, or simply want to talk about this song? Start the discussion! Songs you might like A Thousand Years[ Christina Perri ] 11 Januari[ Gigi ] Can't Take My Eyes Off Of You[ Frankie Valli ] Seberapa Pantas[ Sheila On 7 ] Love Story[ Taylor Swift ] A Whole New World[ Disney ] Shallow[ Lady GAGA ] Karena Kamu Cuma Satu[ Naif ] Fly Me To The Moon[ Frank Sinatra ] Perfect [ Ed Sheeran ] Top Tabs & Chords by Slank, don't miss these songs! Ku Tak BisaAbout this song Ku Tak BisaNo information about this song. Did you cover Ku Tak Bisa on your Ukulele? Share your work! Submit a cover
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose AAACAAAAAAAAAAAAAAAAEmAAAAAAFAAAAAAACAAAAGAACAAAAAAAEmAAAAAAAFAAAAAAACAAAGmAAADADmAAAAAFAAAAAAACAAAAAAAGAAAAAAADmAAAAAAAAFAAAAAACAAAAAAAAGAAAAAACAAAAAAAAAAAAAAAAEmAAAAAAFAAAAAAACAAAGAAACAAAAAAAAEmAAAAAAFAAAAAACAAAGAAAADmAAAAAAAFAAAAAACAAAAAAAAGAAAAAAADmAAAAAAAFAAAAAACAAAAAAAGAAAAAAAAAmAAAAAAAEmAAAAAAAAmAAAAAAEmAAAAAAAAAAAAAAAGmAAAAAAAABAAAADmAAmAAAAAAAEmAAAAAAAAmAAAAAAAEmAAAAAAAFAAAAAAAFmAAAAAAAAAAFAAAAAAAACAAAADmAAAAAAAAAFAAAAAAAACAAAAAAGmAGAAACDmAAAAAAAAAFAAAAAAAACAAAAAAAGAAAAAAAAAAACADADmAAAAAAFAAAAAAACAAAAAAGAAAAAAAADmAAAAAAAFAAAAAAACAAAAAAGAABmAAGADmAAAAAAAFAAAAAAACAAAAAAGAAAAAAAAAAAAAADmAAAAAAAAFAAAAAACAAAAAAAAAAAAAAAAAAN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNEmNNNNNNNFNNNNNNNNNNNGNNNCNNNNNNNEmNNNNNNNFNNNNNNNCNNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNCNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNCNNNNNNNNNNNNNNNEmNNNNNNNFNNNNNNCNNNGNNNCNNNNNNNNNEmNNNNNFNNNNNNNCNNNGNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNAmNNNNNNNEmNNNNNNNAmNNNNNNNEmNNNNNNNANNNNNNNGmNNNNNNNBmNNNNNNNAmNNNNNNNEmNNNNNNNAmNNNNNNNEmNNNNNNNFNNNNNNNFmNNNNNNNNNNNNNNNNNNNDmNNNNNNNNFNNNNNNNCNNNNNNNGNNNNCNNDmNNNNNNNFNNNNNNNNCNNNNNNNGNNNNNNNNNNNFNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNGNNNDNNNDmNNNNNNNFNNNNNNNCNNNNNNNGNNNNNNNNNNNNNNNDmNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNEmNNNNNNNNFNNNNNNNNNNNNGNNNCNNNNNNNNEmNNNNNNNFNNNNNNNNNCNNNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNNNNGNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNCNNNNNNNNNNNNNNNNEmNNNNNNNNFNNNNNNNCNNNNGNNNCNNNNNNNEmNNNNNNNNFNNNNNNNCNNNNGNNNNNDmNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNAmNNNNNNNNEmNNNNNNNAmNNNNNNNNEmNNNNNNNNANNNNNNNGmNNNNNNNBmNNNNNNDmNANNNNNNNENNNNNNNNANNNNNNNENNNNNNNNFNNNNNNNNFmNNNNNNNNNNNNNNNNNNNNDmNNNNNNNNNFNNNNNNNCNNNNNNNNGNNNNNNNNNDmNNNNNNFNNNNNNNNCNNNNNNNNGNNNNNNNNNNNNNCNDmNNNNNNNNNFNNNNNNNCNNNNNNNNGNNNNNNNNDmNNNNNNNFNNNNNNNCNNNNNNNNNANNNNNNDmNNNNNNNFNNNNNNNNCNNNNNNNGNNNNNNNNNNNNNNDmNNNNNNNNNNNNFNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
chord ku tak bisa ukulele